Question: Compare DNA and RNA with regard to their structure, function, location, and activity. Ho do these molecules differ with regard to the polymerases used to synthesize them?
Question: AN E. coli transcript with the first two nucleotides 5′-AG-3′ is initiated from the segment of double-stranded DNA in Figure 5.A below:
a. Where is the transcription start site?
b. What are the approximate locations of the regions that bind the RNA polymerase homoenzyme?
c. Does transcription elongation proceed toward the right or left?
d. Which DNA strand is the template strand?
e. Which DNA strand is the RNA-coding strand?
Figure 5.A
5′-TAGTGTATTGACATGATAGAAGCACTCTTACTATAATCTCAATAGCTAACG-3′
3′-ATCACATAACTGTACTATCTTCGTGAGAATGATATTAGAGTTATCGATGC -5′
Why Choose Us
Top quality papers
We always make sure that writers follow all your instructions precisely. You can choose your academic level: high school, college/university or professional, and we will assign a writer who has a respective degree.
Professional academic writers
We have hired a team of professional writers experienced in academic and business writing. Most of them are native speakers and PhD holders able to take care of any assignment you need help with.
Free revisions
If you feel that we missed something, send the order for a free revision. You will have 10 days to send the order for revision after you receive the final paper. You can either do it on your own after signing in to your personal account or by contacting our support.
On-time delivery
All papers are always delivered on time. In case we need more time to master your paper, we may contact you regarding the deadline extension. In case you cannot provide us with more time, a 100% refund is guaranteed.
Original & confidential
We use several checkers to make sure that all papers you receive are plagiarism-free. Our editors carefully go through all in-text citations. We also promise full confidentiality in all our services.
24/7 Customer Support
Our support agents are available 24 hours a day 7 days a week and committed to providing you with the best customer experience. Get in touch whenever you need any assistance.
Try it now!
How it works?
Follow these simple steps to get your paper done
Place your order
Fill in the order form and provide all details of your assignment.
Proceed with the payment
Choose the payment system that suits you most.
Receive the final file
Once your paper is ready, we will email it to you.
Our Services
No need to work on your paper at night. Sleep tight, we will cover your back. We offer all kinds of writing services.
Essays
You are welcome to choose your academic level and the type of your paper. Our academic experts will gladly help you with essays, case studies, research papers and other assignments.
Admissions
Admission help & business writing
You can be positive that we will be here 24/7 to help you get accepted to the Master’s program at the TOP-universities or help you get a well-paid position.
Reviews
Editing your paper
Our academic writers and editors will help you submit a well-structured and organized paper just on time. We will ensure that your final paper is of the highest quality and absolutely free of mistakes.
Reviews
Revising your paper
Our academic writers and editors will help you with unlimited number of revisions in case you need any customization of your academic papers