Show the graphical phylogenetic relationship | Homework Helpers

A. MICROBIOME

1) In the accompanying microbiome dataset 12, which includes the known 16SrRNA sequences of 5 different gut microbiota, identify which species the last sequence (seq5) corresponds to.

Don't use plagiarized sources. Get Your Custom Essay on
Show the graphical phylogenetic relationship | Homework Helpers
Get an essay WRITTEN FOR YOU, Plagiarism free, and by an EXPERT!
Order Essay

2) Identify a substring in each sequence of no more than 30 bases that uniquely distinguishes each species but comes from the same region of the sequence. Report the coordinates (relative to seq1) where your substring came from, and write out the 5 unique sequences as they would appear in a multiple alignment.

3) Why do you think the region where your substring came from is more variable than most of the rest of the sequence?

4) Dataset 1 and dataset 2 were derived from 16s sequencing of a malnourished and well fed individual respectively, with all other variables (e.g. age, sex) perfectly matched. Using the substrings above, count the number of 16s rRNA derived from the 5 species you identified above. The “find” function in excel may be useful here. You can assume that there exist no other species with the same substring as those that you are measuring. Report your counts in table format with column headings: dataset 2, dataset 3, and row labels: your 5 species. (3 marks) N.B. “.tab” (tab-delimited) files can be opened with Excel. For Mac users, you may need to change it to “.txt” before opening.

6) Which of the 5 species differs the most in its abundance between the two individuals?

B. CONSERVATION AND POSITIVE SELECTION OF NON-CODING RNA

Many non-coding RNAs are turning out to have very important conserved functions. The HAR1A (Human accelerated region 1) sequenceis expressed in human cerebral cortex during early human development.  Part of the sequence appears to be under strong positive selection and is referred to as Human accelerated region 1

1. Use BLAT to call up the sequence forHuman Accelerated Region A  (HAR1A) using the following segment of human HAR1A:   AGACGTTACAGCAACGTGTCAGCTGAAATGATGGGCGTAGACGCACGT

Show the screen shot.

2. Is the conservation limited to this short search sequence?  Show data.

3. Do a CLUSTALW alignment of the region in 1) plus 100 nucleotides from either side for vertebrates ranging from Human to fish. Use at least 10 species and include available primates as well as the species in Question 5. Show the alignment.

4. Show the graphical phylogenetic relationship using the alignment.

5. How many changes are present between the Human and Chimp? Chimp to Mouse? Chimp to Opossum?

C. GENEMANIA AND BIOGRID

Links to these sites and descriptive material in Nucleic Acids Research are shown below.

GENEMANIAhttp://genemania.org/

NAR: https://academic.oup.com/nar/article/38/suppl_2/W214/1126704/The-GeneMANIA-prediction-server-biological-network

BIOGRID https://thebiogrid.org/

NAR: https://academic.oup.com/nar/article/45/D1/D369/2681732/The-BioGRID-interaction-database-2017-update

1. Go to Genemania.

Choose a protein of interest that is present in any of the species (dropdown icon, upper left panel).  On the right side of the upper left panel is a drop down menu to toggle on/off various types of interaction.  Turn off everything except Physical interactions. Show the output.

2. The image will show reported physical interactions as well as predicted interactions. The displayed information will show on the right hand side of the page. Turn off everything except the one you searched for. Try toggling on/off the various types of data on the left hand menu.   Show at least three variations on the theme. Be sure to include Attributes alone.

3. Go to BioGrid and input the same protein/organism. The initial image displays all information. On the Switch View panel click the Interactors, Interactions, and then Network.  Show image of the last one. How does the view compare to Genemania?

Attachment:- Assignment Files.rar

Calculate your paper price
Pages (550 words)
Approximate price: -

Why Choose Us

Top quality papers

We always make sure that writers follow all your instructions precisely. You can choose your academic level: high school, college/university or professional, and we will assign a writer who has a respective degree.

Professional academic writers

We have hired a team of professional writers experienced in academic and business writing. Most of them are native speakers and PhD holders able to take care of any assignment you need help with.

Free revisions

If you feel that we missed something, send the order for a free revision. You will have 10 days to send the order for revision after you receive the final paper. You can either do it on your own after signing in to your personal account or by contacting our support.

On-time delivery

All papers are always delivered on time. In case we need more time to master your paper, we may contact you regarding the deadline extension. In case you cannot provide us with more time, a 100% refund is guaranteed.

Original & confidential

We use several checkers to make sure that all papers you receive are plagiarism-free. Our editors carefully go through all in-text citations. We also promise full confidentiality in all our services.

24/7 Customer Support

Our support agents are available 24 hours a day 7 days a week and committed to providing you with the best customer experience. Get in touch whenever you need any assistance.

Try it now!

Calculate the price of your order

Total price:
$0.00

How it works?

Follow these simple steps to get your paper done

Place your order

Fill in the order form and provide all details of your assignment.

Proceed with the payment

Choose the payment system that suits you most.

Receive the final file

Once your paper is ready, we will email it to you.

Our Services

No need to work on your paper at night. Sleep tight, we will cover your back. We offer all kinds of writing services.

Essays

Essay Writing Service

You are welcome to choose your academic level and the type of your paper. Our academic experts will gladly help you with essays, case studies, research papers and other assignments.

Admissions

Admission help & business writing

You can be positive that we will be here 24/7 to help you get accepted to the Master’s program at the TOP-universities or help you get a well-paid position.

Reviews

Editing your paper

Our academic writers and editors will help you submit a well-structured and organized paper just on time. We will ensure that your final paper is of the highest quality and absolutely free of mistakes.

Reviews

Revising your paper

Our academic writers and editors will help you with unlimited number of revisions in case you need any customization of your academic papers