Below is a segment of bacterial Lac Operon sequence. An E. coli transcript with the first 5 nucleotides 5′ AUGU3′. Carefully examine the sequence and then answer the questions.
Strand A: 5’GCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAAGTTAATCACACAGGAAACAGCTATGACCATGATT 3′
Strand B: 3’CGAAATGTGAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTCAATTAGTGTGTCCTTTGTCGATACTGGTACTAA 5′
A. Where is the trascription start site?
B. find TTTACA around -35 region and box it. (my answer is highlighted in yellow above)
C. find TATGTT around -10 region and box it. (my answer highlighted pink above)
D. lable template and coding strands (my answer: template is strand B and coding is strand A)
E. does transcription elongation proceed towards the right or left? (my answer: right)
F. write the sequence of the primary RNA transcript starting at 5′ aUUGU3′. include polarity of the transcript.
LDR 3302-21.01.01-1A24-S1, Organizational Theory and Behavior Unit III Essay Top of Form Bottom of Form…
Chapter 9 What are teratogens? Give 5 examples. Define each of these stages: Germinal, embryonic,…
You are a Financial Analyst that has been appointed to lead a team in the…
You are familiar with the ANA Code of Ethics and have a growing understanding of…
This week’s discussion will focus on management decision-making and control in two companies, American corporation…
Mary Rowlandson felt that the man who eventually came to own her, Quinnapin, was “the…