Write the sequence of the primary rna transcript | Homework Helpers

Below is a segment of bacterial Lac Operon sequence. An E. coli transcript with the first 5 nucleotides 5′ AUGU3′. Carefully examine the sequence and then answer the questions.
Strand A: 5’GCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAAGTTAATCACACAGGAAACAGCTATGACCATGATT 3′
Strand B: 3’CGAAATGTGAAATACGAAGGCCGAGCATACAACACACCTTAACACTCGCCTATTCAATTAGTGTGTCCTTTGTCGATACTGGTACTAA 5′
A. Where is the trascription start site?
B. find TTTACA around -35 region and box it. (my answer is highlighted in yellow above)
C. find TATGTT around -10 region and box it. (my answer highlighted pink above)
D. lable template and coding strands (my answer: template is strand B and coding is strand A)
E. does transcription elongation proceed towards the right or left? (my answer: right)
F. write the sequence of the primary RNA transcript starting at 5′ aUUGU3′. include polarity of the transcript.

Don't use plagiarized sources. Get Your Custom Essay on
Write the sequence of the primary rna transcript | Homework Helpers
Get an essay WRITTEN FOR YOU, Plagiarism free, and by an EXPERT!
Order Essay
superadmin

Recent Posts

LDR 3302-21.01.01-1A24-S1, Organizational Theory and Behavior

LDR 3302-21.01.01-1A24-S1, Organizational Theory and Behavior Unit III Essay Top of Form Bottom of Form…

3 years ago

Psychology Question | My Essay Helpers

Chapter 9 What are teratogens? Give 5 examples. Define each of these stages: Germinal, embryonic,…

3 years ago

Financial Market Analysis | My Essay Helpers

You are a Financial Analyst that has been appointed to lead a team in the…

3 years ago

Decision theory | My Essay Helpers

This week’s discussion will focus on management decision-making and control in two companies, American corporation…

3 years ago

Literature Question | My Essay Helpers

Mary Rowlandson felt that the man who eventually came to own her, Quinnapin, was “the…

3 years ago