Find the location and sequence of the TAS2R38 gene in humans | Homework Helpers

Part -1:

We are currently in a ‘post-genomic’ era, in which the genomes from a number of organisms have been sequenced. As researchers, we can use these sequences and their associated bioinformatics tools to answer a wide-variety of questions.

Don't use plagiarized sources. Get Your Custom Essay on
Find the location and sequence of the TAS2R38 gene in humans | Homework Helpers
Get an essay WRITTEN FOR YOU, Plagiarism free, and by an EXPERT!
Order Essay

Bioinformatics is a sub-discipline of biology that conducts experiments in silico (on the computer) to complement experiments in vivo and in vitro. The algorithms that exist can be used to identify genes, promoters and functional elements within DNA. We will use free, online tools to identify the sequence of the allele that you are testing in lab and to understand the evolution of the TAS2R38 gene.

Follow the instructions below, then use the information you’ve gathered to answer the questions at the bottom.

I. Use the UCSC Genome Browser to find the location and sequence of the TAS2R38 gene in humans.

a. Open the internet site: www.genome.ucsc.edu

b. At the top left, click ‘Genome Browser’. The genome browser is server that collects and annotates genomic information that is produced by laboratories around the world. It houses the genome sequence information for a number of organisms, including Homo sapiens.

c. When you enter the browser, you will see a search window. Make sure that each of the following is set correctly, then enter TAS2R38 in the search term box and click ‘submit’.

Group: Mammal Genome: Human
Assembly: Feb. 2009 (GRCh37/hg19)
Position: can be any value

d. When the search finishes, choose TAS2R38 from beneath the UCSC Genes category. This will bring up a ‘browser’, which will allow you to see the gene in its genomic position. Notice some key features, including the chromosome number and position, and the size of the gene, listed near the top. The gene itself is shown in blue. Depending on the defaults set, there may be a number of aIDitional ‘tracks’ shown – ignore these for now.

Write down the following:

Chromosome Number: _____

Transcription start and stop positions:_____

IMPORTANT: This gene is on the minus (-) strand, so it reads right to left as you’re looking at it in the browser. The start position is GREATER THAN the stop position.

Size of the coding region for this gene:______

e. We will perform an in silico PCR reaction within the genome browser. In short, we will type in the primer sequences, the program will match the primers to their genomic and show us the region that will be amplified. Start by clicking ‘Tools” at the top, and choosing “In silico PCR”.

f. Enter in the Forward and Reverse Primer sequences and click ‘Submit’

Forward: 5′ – CCTTCGTTTTCTTGGTGAATTTTTGGGAT – 3′

Reverse: 5′ – AGGTTGGCTTGGTTTGCAATCATC – 3′

g. The window that comes up will give you some information. Write down the following: Chromosome number of the amplified region:
Position of the amplified region (base-pairs):

Size of the amplified PCR product:_____

Calculate the distance between the start of the product and the start of the gene (base pairs). Remember that the start site is greater than the stop site.

h. Copy the predicted PCR product to another file (Text, Word, Google Docs, etc).

i. Click on the chromosomal position link (highlighted in blue) to see where your product is in the genome browser. The program default will zoom in to the PCR product. Use the tools near the top to zoom out 10X. Notice that the product is near the start of the gene (see IMPORTANT note above).

II. Use BLAST to identify homologous sequences from a number of species.

a. Open the internet site: blast.ncbi.nlm.nih.gov/

b. Under ‘Basic BLAST’ choose nucleotide blast

c. Copy the sequence of your PCR product into the Query box.

d. Confirm that the settings are identical to those listed below and click BLAST. The query sequence will be sent to the National Center for Biotechnology Information in Bethesda, Maryland. There, the BLAST algorithm will attempt to match the sequence to the millions of DNA sequences in the database.

Database: Nucleotide collection (nr/nt) Organism: Leave blank

Entrez Query: Leave Blank

Optimize for: Highly similar sequences (megablast)

When all the settings are correct click ‘BLAST’ at the bottom of the page.

e. Take a moment to explore the data. First, a graphical overview illustrates how significant matches, called ‘hits’, align with the query sequence. Matches of differing lengths are coded by color.

Next, a list of significant alignments is listed with their associated geneinfo (gi) links. This list includes the E-values, which are analogous to a p-value and give an indication of how likely it would be to get this particular match by chance. A low E-value indicates a more significant match (ie: it was less likely to be achieved by chance alone).

Last, there is a detailed view of the sequence of each ‘hit’ (subject) aligned to the query. Notice that there are lines between identical alignments and gaps where the sequence differs between the subject and the query.

f. Look closely at the significant alignments. There are several matches to the Homo sapiens genome, including the RefSeq (Reference Sequence) on chromosome 7, several partial CDS (coding sequences) and the complete coding CDS. Scroll through these data, identify each of the following sequences and list their E-values.

Homo sapiens PTC bitter taste receptor (PTC) gene, PTC-non-taster allele, complete CDS E-value:

Homo sapience PTC bitter taste receptor (PTC) gene, PTC-taster allele, complete CDS E-value:

Gorilla gorilla chromosome 7, taste receptor T2R38 gene, complete cds E-value:

Pan troglodytes chromosome 7, taste receptor T2R38, complete cds.

E-value:_____

Pan paniscus, taste receptor T2R39 (TAS2R) gene, complete cds E-value:_____

g. You will need the sequences for the next steps. Click the ‘accession number’ link to the right of each of the sequences listed above. This will take you to a new page that includes the complete sequence of that organism at the bottom of the page. Copy the complete sequence to a new document (Text, Word, Google docs, etc.) so you have them for reference below. (You can include the numbers in your copied information).

III. Use multiple alignment to Explore the Evolution of the TAS2R38 gene.

a. Open the Bioservers internet site at the Dolan DNA learning center: www.bioservers.org

b. Enter the Sequence Server using the button in the left-hand column. (Note, make sure to click ‘Enter’ under Sequence Server. Clicking ‘Sequence Server’ won’t work). You don’t have to register unless you wish to save your results for future reference.

c. Click ‘Create Sequence’ at the top, near the miIDle of the screen. Enter each of your sequences for the Taster Allele, the Non-taster allele, the Gorilla allele, the Chimp (troglodytes) allele and the Bonobo allele (paniscus). When all sequences have been entered, click the X to exit the pop-up window.

d. Begin by comparing the Taster and Non-taster alleles. Click the box to the left of each sequence, then click Compare in the grey bar. The program will default to use an algorithm called Clustal-W. The checked sequences are sent to a server at Cold Spring Harbor Laboratory, where the Clustal-W algorithm will attempt to align each nucleotide sequence.

The results will appear in a new window. The sequences are displayed in rows of 25 nucleotides. Yellow highlighting denotes mismatches between sequences or regions where only one sequence begins or ends before another.

Change the segment that says “show per page” so that the whole sequence is visible.

e. Repeat step D for each of the following comparisons. Take notes in the space provided about the differences between sequences.

(1) PTC Taster vs PTC Non-taster

Nucleotide Position

Taster Nucleotide

Non-taster Nucleotide

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

(2) PTC Taster vs PTC Non-taster vs Chimpanzee vs Bonobo vs. Gorilla

Nucleotide position

Taster

Non-taster

Chimp

Bonobo

Gorilla

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Part -2:

Show ALL calculations and use complete sentences. One-word answers will never be given credit.

1. Use the UCSC Genome Browser to find each of the following pieces of information:

a. What is the subcellular location of TAS2R38 protein?

b. What tissues is TAS2R38 expressed in?

c. What other phenotypes, other than bitter tasting, have been associated with genotype at TAS2R38?

2. Use the UCSC Genome Browser to identify the DNA sequence of the TAS2R38 gene. Hint: Clicking ‘View’ then ‘DNA’ will bring up a window with the sequence of everything shown in the current viewing window. Make sure that the gene is fully in the window and no extra sequence is present. Then, this tool will automatically bring up the sequence 5′ to 3′ as the sequence reads left to right. If your sequence is on the minus (-) strand (in other words, if it reads right to left in the genome), you can click a box in the sequence window to get the sequence of the Reverse Complement.

Write the sequence of the first 20 nucleotides of the TAS2R38 gene beginning at the 5′ end of the transcribed region.

3. Using the complete gene sequence you obtained in Q2, perform a BLAST search of the complete TAS2R38 gene. List the complete name of first 3 non-human, significant matches with complete CDS and their E-values.

4. Using your BLAST search results, copy the sequences for the complete CDS sequence from the PTC taster allele, PTC non-taster allele, Gorilla allele, Chimpanzee (Pan troglodytes) allele and Bonobo (Pan paniscus) allele to a new file. Use the Bioserver website to compare these sequences and answer the following questions:

a. What is the ancestral (original) state of this gene at nucleotide positions 145, 785 and 886?

Position

Ancestral Nucleotide (A, T, C or G)

145

 

785

 

886

 

b. Are the non-human primates PTC tasters or non-tasters based on this data?

5. Use your data from the activity to compare the complete PTC taster allele, the complete non-taster allele and the region amplified by your PCR reaction. Answer the following questions:

a. The full forward primer sequence is given below. Use Bioservers to align this primer to your sequences. Looking at your ClustalW data, where does the end of the primer bind? What discrepancy do you notice between the primer sequence and the TAS2R38 sequence? What consequence does that have for your experiment? (Hint: How would the primer change the sequence of the product when compared to the original sequence.)

Primer sequence: 5′-CCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCGG-3′

b. Given the location of the amplified PCR product, which of the 3 Single Nucleotide Polymorphisms (SNPs) given in Q4a was assessed here?

Count codons (3-nucleotide sets) from the start of the complete Taster allele to the SNP assessed in your PCR reaction. Assume that you are looking at the Coding strand. In the taster allele, which amino acid is coded at the SNP assessed by PCR? Which amino acid is encoded in the non-taster allele? (Note: You will need a codon table – one can be found in your textbook on page 457).

 

Codon

Amino-Acid coded

Taster

 

 

Non-Taster

 

 

How is the amino-acid chemistry in the protein altered by the SNP? Provide an explanation for how this change might lead to the phenotypes of tasting and non- tasting.

superadmin

Recent Posts

LDR 3302-21.01.01-1A24-S1, Organizational Theory and Behavior

LDR 3302-21.01.01-1A24-S1, Organizational Theory and Behavior Unit III Essay Top of Form Bottom of Form…

3 years ago

Psychology Question | My Essay Helpers

Chapter 9 What are teratogens? Give 5 examples. Define each of these stages: Germinal, embryonic,…

4 years ago

Financial Market Analysis | My Essay Helpers

You are a Financial Analyst that has been appointed to lead a team in the…

4 years ago

Decision theory | My Essay Helpers

This week’s discussion will focus on management decision-making and control in two companies, American corporation…

4 years ago

Literature Question | My Essay Helpers

Mary Rowlandson felt that the man who eventually came to own her, Quinnapin, was “the…

4 years ago