Comparing dna and rna, Compare DNA and RNA with regard to | Homework Helpers

Question: Compare DNA and RNA with regard to their structure, function, location, and activity. Ho do these molecules differ with regard to the polymerases used to synthesize them?

Question: AN E. coli transcript with the first two nucleotides 5′-AG-3′ is initiated from the segment of double-stranded DNA in Figure 5.A below:
a. Where is the transcription start site?
b. What are the approximate locations of the regions that bind the RNA polymerase homoenzyme?
c. Does transcription elongation proceed toward the right or left?
d. Which DNA strand is the template strand?
e. Which DNA strand is the RNA-coding strand?
Figure 5.A
5′-TAGTGTATTGACATGATAGAAGCACTCTTACTATAATCTCAATAGCTAACG-3′
3′-ATCACATAACTGTACTATCTTCGTGAGAATGATATTAGAGTTATCGATGC -5′